Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311504

Morpholino Name: wnt8a MO6
Synonyms: TNeu118d19, Xtwnt8.2
Target mRNA: wnt8a

Morpholino Type: uncategorized morpholino
Sequence: 5' GACAAACAAAGTGGTGTTCTTCATG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 21/25 22/25
genomic

MO
5' CATGAAGAACACCACTTTGTTTGTC 3' ||||||||||||||||||||||||| 3' GTACTTCTTGTGGTGAAACAAACAG 5' 5' CATGCAAAACACCACTTTGTTCATC 3' |||| | |||||||||||||| || 3' GTACTTCTTGTGGTGAAACAAACAG 5' 5' CATGAAAAGCGCCACTTTGTTTGTC 3' |||||| | | |||||||||||||| 3' GTACTTCTTGTGGTGAAACAAACAG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr3S:113785781..113785805 22/25 Antisense target wnt8a.S
chr3L:24522261..24522285 21/25 Antisense target wnt8a.L
chr4L:16679953..16679977 21/25 Sense off-target myrf.L
chr8L:68824681..68824705 21/25 Sense off-target prpf39.1.L
tropicalis 10.0 Chr3:31431155..31431179 25/25 Antisense target wnt8a
Chr5:74402402..74402426 21/25 Sense off-target ros1
Chr6:106245336..106245360 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers