Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311508

Morpholino Name: baz1b MO2
Synonyms: TEgg058h11, Xtznfp4
Target mRNA: baz1b

Morpholino Type: uncategorized morpholino
Sequence: 5' CGGGAACAAGGCGAGAGGCTGCGTG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25
genomic

MO
5' CACGCAGCCTCTCGCCTTGTTCCCG 3' ||||||||||||||||||||||||| 3' GTGCGTCGGAGAGCGGAACAAGGGC 5' 5' CGCGCAGCCTCTCGCCTTGTTCCCG 3' | ||||||||||||||||||||||| 3' GTGCGTCGGAGAGCGGAACAAGGGC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr2L:40963412..40963436 24/25 Antisense target baz1b.L
tropicalis 10.0 Chr2:41898342..41898366 25/25 Antisense target baz1b
Chr2:41898342..41898366 25/25 Sense off-target nsun5
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers