Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311509

Morpholino Name: loc100135120 MO1
Synonyms: TEgg023k12, Xtznfp5
Target mRNA: XB5729191 [provisional]

Morpholino Type: uncategorized morpholino
Sequence: 5' CCTTAGGGAACGCATTTCCAGCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr1L:115174983..115175007 21/25 unknown
chr3L:47237420..47237444 21/25 unknown
tropicalis 10.0 Chr3:47576479..47576503 25/25 Antisense off-target LOC100135120
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers