Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311510

Morpholino Name: zbed4 MO1
Synonyms: TEgg003g16, Xtznfp6
Target mRNA: zbed4

Morpholino Type: uncategorized morpholino
Sequence: 5' TTCTTCAGCAAGATTACTTTCCATT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 22/25 22/25
genomic

MO
5' AATGGAAAGTAATCTTGCTGAAGAA 3' ||||||||||||||||||||||||| 3' TTACCTTTCATTAGAACGACTTCTT 5' 5' AATGGAAAGTAGTCTTATTGAAGAA 3' ||||||||||| |||| ||||||| 3' TTACCTTTCATTAGAACGACTTCTT 5' 5' AATGGAAAGTATTCTGACTGAAGAA 3' ||||||||||| ||| |||||||| 3' TTACCTTTCATTAGAACGACTTCTT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr3L:63608732..63608756 23/25 Antisense target zbed4.L
chr3L:63608477..63608501 22/25 Antisense target zbed4.L
chr3S:75163481..75163505 22/25 Antisense target zbed4.S
chr9_10L:58127730..58127754 22/25 Sense off-target cacnb4.L
chr2S:131330876..131330900 21/25 Antisense off-target LOC101027278 [provisional:asic1]
chr9_10L:25966541..25966565 22/25 unknown
tropicalis 10.0 Chr3:72499538..72499562 25/25 Antisense target zbed4
Chr2:156735620..156735644 21/25 Sense off-target spata13
Chr5:93230732..93230756 21/25 Antisense off-target col9a1
Chr3:67119658..67119682 21/25 unknown
Chr8:88997170..88997194 21/25 unknown
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers