Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311511

Morpholino Name: rnf112 MO1
Synonyms: TGas143j10, Xtznfp7
Target mRNA: rnf112

Morpholino Type: uncategorized morpholino
Sequence: 5' GCCGCTCCATGTTTGTATTATAGGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GCCTATAATACAAACATGGAGCGGC 3' ||||||||||||||||||||||||| 3' CGGATATTATGTTTGTACCTCGCCG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr1L:189702223..189702247 21/25 Sense off-target serinc5.L
tropicalis 10.0 Chr9:7207612..7207636 25/25 Antisense target rnf112
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers