Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311512

Morpholino Name: arfgap2 MO1
Synonyms: TEgg043a17, Xtznfp8
Target mRNA: arfgap2

Morpholino Type: uncategorized morpholino
Sequence: 5' CCGCTTTAGTCGGCTCGGCTGCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25 24/25
genomic

MO
5' ATGGCAGCCGAGCCGACTAAAGCGG 3' ||||||||||||||||||||||||| 3' TACCGTCGGCTCGGCTGATTTCGCC 5' 5' ATGGCAGCCGAGCCGACTAAAGCCG 3' ||||||||||||||||||||||| | 3' TACCGTCGGCTCGGCTGATTTCGCC 5' 5' ATGGCAGCCGAGCCGACTAAAGCCG 3' ||||||||||||||||||||||| | 3' TACCGTCGGCTCGGCTGATTTCGCC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr4L:8480620..8480644 24/25 Antisense target arfgap2.L
chr4S:14662132..14662156 24/25 Antisense target arfgap2.S
tropicalis 10.0 Chr4:11585338..11585362 25/25 Antisense target arfgap2
Chr4:11585338..11585362 25/25 Sense off-target Xetrov107028178m.g
Publications
First: Defining synphenotype groups in Xenopus tropicalis by use of antisense morpholino oligonucleotides., PLoS Genet 2006                                      
Most recent:
View All Papers