Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311608

Morpholino Name: tacc3 MO2
Synonyms:
Target mRNA: tacc3

Morpholino Type: splice blocking morpholino
Sequence: 5' AGTTGTAGGCTCATTCTAAACAGGA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 23/25
genomic

MO
5' TCCTGTTTAGAATGAGCCTACAAAT 3' ||||||||||||||||||||||| | 3' AGGACAAATCTTACTCGGATGTTGA 5' 5' TCCTGTTTAGAATGAGCCTACAACT 3' ||||||||||||||||||||||||| 3' AGGACAAATCTTACTCGGATGTTGA 5' 5' TCCTGTTTAGAATGAGCCTTCAAAT 3' ||||||||||||||||||| ||| | 3' AGGACAAATCTTACTCGGATGTTGA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr1L:12314549..12314573 25/25 Antisense target tacc3.L
chr1S:11593720..11593744 23/25 Antisense target tacc3.S
chr1L:145005398..145005422 21/25 Antisense off-target rbm19.L
chr2S:118615916..118615940 21/25 Sense off-target ccdc65.S
tropicalis 10.0 Chr1:20379895..20379919 24/25 Antisense target tacc3
Publications
First: TACC3 is a microtubule plus end-tracking protein that promotes axon elongation and also regulates microtubule plus end dynamics in multiple embryonic cell types., Mol Biol Cell 2014                                
Most recent: Wolf-Hirschhorn Syndrome-Associated Genes Are Enriched in Motile Neural Crest Cells and Affect Craniofacial Development in Xenopus laevis., Front Physiol 2019                                            
View All Papers