Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311791

Morpholino Name: prdm12 MO2
Synonyms:
Target mRNA: prdm12

Morpholino Type: uncategorized morpholino
Sequence: 5' CCGGCAGCACCGAGCCCATCATTAA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25
genomic

MO
5' TTGATGATGGGCTCGGTGCTGCCGG 3' || |||||||||||||||||||||| 3' AATTACTACCCGAGCCACGACGGCC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr8S:33737696..33737720 23/25 Antisense off-target LOC108699953 [provisional:prdm12]
chr1L:57187535..57187559 21/25 Antisense off-target sclt1.L
Scaffold46:929367..929391 24/25 unknown
chr1S:96060617..96060641 21/25 unknown
tropicalis 10.0 Chr8:12935564..12935588 24/25 Antisense target prdm12
Chr5:145109603..145109627 21/25 Sense off-target klhl29
Chr9:75879665..75879689 21/25 Antisense off-target stam2
Chr1:167009240..167009264 21/25 unknown
Chr5:107671570..107671594 21/25 unknown
Chr5:34729025..34729049 21/25 unknown
Publications
First: The evolutionarily conserved transcription factor PRDM12 controls sensory neuron development and pain perception., Cell Cycle 2015      
Most recent: Prdm12 specifies V1 interneurons through cross-repressive interactions with Dbx1 and Nkx6 genes in Xenopus., Development 2015                                      
View All Papers