Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17311792

Morpholino Name: prdm12 MO3
Synonyms:
Target mRNA: prdm12

Morpholino Type: uncategorized morpholino
Sequence: 5' CATTAATTCTGCCTGCGAGTCTGAC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/25
genomic

MO
5' GCCAGACTCCCAGGCAGAATTGATG 3' | ||||||| ||||||||||| ||| 3' CAGTCTGAGCGTCCGTCTTAATTAC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr2L:67109785..67109809 21/25 Antisense off-target tnnt2.L
Scaffold46:929348..929372 23/25 unknown
tropicalis 10.0 Chr8:12935583..12935607 22/25 Antisense target prdm12
Publications
First: The evolutionarily conserved transcription factor PRDM12 controls sensory neuron development and pain perception., Cell Cycle 2015      
Most recent: Prdm12 specifies V1 interneurons through cross-repressive interactions with Dbx1 and Nkx6 genes in Xenopus., Development 2015                                      
View All Papers