Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17326618

Morpholino Name: exosc9 MO1
Synonyms: MoExosc9
Target mRNA: exosc9

Morpholino Type: uncategorized morpholino
Sequence: 5' CGTCTCCTTCATGTCTGTAACACAC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 25/25
genomic

MO
5' GTATGTTATAGACATGAAGGAGACG 3' || ||||| |||||||||||||||| 3' CACACAATGTCTGTACTTCCTCTGC 5' 5' GTGTGTTACAGACATGAAGGAGACG 3' ||||||||||||||||||||||||| 3' CACACAATGTCTGTACTTCCTCTGC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr1L:59787508..59787532 25/25 Antisense target exosc9.L
chr3L:38964616..38964640 21/25 Sense off-target pdlim7.L
chr6S:49812595..49812619 22/25 unknown
tropicalis 10.0 Chr1:66858380..66858404 23/25 Antisense target exosc9
Publications
First: Ptbp1 and Exosc9 knockdowns trigger skin stability defects through different pathways., Dev Biol 2016                  
Most recent: Morpholinos Do Not Elicit an Innate Immune Response during Early Xenopus Embryogenesis., Dev Cell 2019          
View All Papers