Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17326631

Morpholino Name: cacna1h MO2
Synonyms: CAV-MO2, CAV3.2 spMO 2
Target mRNA: cacna1h

Morpholino Type: splice blocking morpholino
Sequence: 5' CCTCATACCTACATGAAAGAGGAGA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 24/25
genomic

MO
5' TCTTCTCTTTCATGTAGGTATGAGG 3' ||| ||||||||||||||||||||| 3' AGAGGAGAAAGTACATCCATACTCC 5' 5' TCTCCTCTTTCATGTAGGTATGAGG 3' ||||||||||||||||||||||||| 3' AGAGGAGAAAGTACATCCATACTCC 5' 5' TCTCCTCTTCCATGTAGGTATGAGG 3' ||||||||| ||||||||||||||| 3' AGAGGAGAAAGTACATCCATACTCC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr9_10L:108966041..108966065 25/25 Antisense target cacna1h.L
chr9_10S:97214017..97214041 24/25 Antisense target cacna1h.S
tropicalis 10.0 Chr9:18183419..18183443 24/25 Antisense target cacna1h
Chr1:16767812..16767836 21/25 Sense off-target alms1
Publications
First: T-type Calcium Channel Regulation of Neural Tube Closure and EphrinA/EPHA Expression., Cell Rep 2015        
Most recent:
View All Papers