Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17327656

Morpholino Name: hmga2 MO4
Synonyms:
Target mRNA: hmga2

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' TTGGCGGGCTCCTTCCCTTGAGCTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' GAGCTCAAGGGAAGGAGCCCGCCAA 3' ||||||||||||||||||||||||| 3' CTCGAGTTCCCTTCCTCGGGCGGTT 5' 5' GAGCTCAAGGGAAGGAGCCCGCCAA 3' ||||||||||||||||||||||||| 3' CTCGAGTTCCCTTCCTCGGGCGGTT 5' 5' GAGCTCAAGGGAAGGAGCCCGCCAA 3' ||||||||||||||||||||||||| 3' CTCGAGTTCCCTTCCTCGGGCGGTT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr3L:49969848..49969872 25/25 Antisense target hmga2.L
chr3S:88445211..88445235 25/25 Antisense target hmga2.S
tropicalis 10.0 Chr3:57496646..57496670 25/25 Antisense target hmga2
Publications
First: Hmga2 is required for neural crest cell specification in Xenopus laevis., Dev Biol 2016                                          
Most recent:
View All Papers