Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17328413

Morpholino Name: pdzrn3 MO1
Synonyms:
Target mRNA: pdzrn3

Morpholino Type: uncategorized morpholino
Sequence: 5' CCAGTTCAAAGCCCATGGTCGGTGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' GCACCGACCATGGGCTTTGAACTGG 3' ||||||||||||||||||||||||| 3' CGTGGCTGGTACCCGAAACTTGACC 5' 5' GCACCGACCATGGGCTTTGAACTGG 3' ||||||||||||||||||||||||| 3' CGTGGCTGGTACCCGAAACTTGACC 5' 5' GCACCGACCATGGGCTTTGAACTGG 3' ||||||||||||||||||||||||| 3' CGTGGCTGGTACCCGAAACTTGACC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr4L:135361680..135361704 25/25 Antisense target pdzrn3.L
chr4S:112697854..112697878 25/25 Antisense target pdzrn3.S
chr1L:68444687..68444711 21/25 unknown
tropicalis 10.0 Chr4:139640232..139640256 25/25 Antisense target pdzrn3
Chr4:139640232..139640256 25/25 Antisense off-target Xetrov107034329m.g
Publications
First: pdzrn3 is required for pronephros morphogenesis in Xenopus laevis., Int J Dev Biol 2016                    
Most recent:
View All Papers