Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17328510

Morpholino Name: Igfbp4 MO1
Synonyms: xigfbp-4 (Mo-s), xigfbp4
Target mRNA: igfbp4

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' ATGTCTGGATATTGCCACCCTGCCCTTTTG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 28/30 29/30 30/30
genomic

MO
5' CAAAAGGGCAGGGTGGCAGTTTCCAGACAT 3' |||||||||||||||||| | ||||||||| 3' GTTTTCCCGTCCCACCGTTATAGGTCTGTA 5' 5' CAGAAGGGCAGGGTGGCAATATCCAGACAT 3' || ||||||||||||||||||||||||||| 3' GTTTTCCCGTCCCACCGTTATAGGTCTGTA 5' 5' CAAAAGGGCAGGGTGGCAATATCCAGACAT 3' |||||||||||||||||||||||||||||| 3' GTTTTCCCGTCCCACCGTTATAGGTCTGTA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr9_10S:1287094..1287123 30/30 Sense target igfbp4.S
chr9_10L:1508403..1508432 29/30 Sense target igfbp4.L
tropicalis 10.0 Chr10:8541715..8541744 28/30 Sense target igfbp4
Publications
First: IGFBP-4 is an inhibitor of canonical Wnt signalling required for cardiogenesis., Nature 2008                          
Most recent:
View All Papers