Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17328511

Morpholino Name: Igfbp4 MO2
Synonyms: igfbp-4, xigfbp-4 (MO-r)
Target mRNA: igfbp4

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' ATGTCAGGTTACTGTCATCCTGCCCTTTTG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
Publications
First: IGFBP-4 is an inhibitor of canonical Wnt signalling required for cardiogenesis., Nature 2008                          
Most recent:
View All Papers