Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17328555

Morpholino Name: prickle3 MO1
Synonyms: Pk3 MO1
Target mRNA: prickle3

Morpholino Type: translation blocking morpholino
Sequence: 5' GGATGCCGCCCGCTCTCTCCCTTA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 21/24
genomic

MO
5' TGAAGGAGAGAGCGGGCGGCATCG 3' | | ||||||||||||||||||| 3' ATTCCCTCTCTCGCCCGCCGTAGG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr8S:35466122..35466145 24/24 Antisense off-target LOC108699981 [provisional:prickle3]
Scaffold45555:398..421 22/24 unknown
Scaffold58536:37..60 21/24 unknown
tropicalis 10.0 Chr8:23942427..23942450 21/24 Antisense target prickle3
Chr2:101587179..101587202 21/24 Sense off-target atp2a3
Chr10:45911735..45911758 20/24 Antisense off-target septin9
Publications
First: The involvement of PCP proteins in radial cell intercalations during Xenopus embryonic development., Dev Biol 2015                                
Most recent: Prickle3 synergizes with Wtip to regulate basal body organization and cilia growth., Sci Rep 2016                              
View All Papers