Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18006093

Morpholino Name: igf2 MO1
Synonyms:
Target mRNA: igf2

Morpholino Type: translation blocking morpholino (5' UTR)
Sequence: 5' AAATGTGTTGGCAGCTCCTCTGGGA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' TCCCAGAGGAGCTGCCAACACATTT 3' ||||||||||||||||||||||||| 3' AGGGTCTCCTCGACGGTTGTGTAAA 5' 5' TCCCAGAGGAGCTGCCAACACATTT 3' ||||||||||||||||||||||||| 3' AGGGTCTCCTCGACGGTTGTGTAAA 5' 5' TCCCAGAGGAGCTGCCAACACATTT 3' ||||||||||||||||||||||||| 3' AGGGTCTCCTCGACGGTTGTGTAAA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr4L:16001879..16001903 25/25 Antisense target igf2.L
chr4S:7417247..7417271 25/25 Antisense target igf2.S
chr4S:7417247..7417271 25/25 Antisense off-target mrpl23.S
Scaffold44882:20..44 21/25 unknown
tropicalis 10.0 Chr4:21981810..21981834 25/25 Antisense target igf2
Chr1:22963742..22963766 21/25 Antisense off-target rgs12
Publications
First: MicroRNAs are critical regulators of tuberous sclerosis complex and mTORC1 activity in the size control of the Xenopus kidney., Proc Natl Acad Sci U S A 2014                                                            
Most recent:
View All Papers