Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18006094

Morpholino Name: ins MO1
Synonyms:
Target mRNA: ins

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' GCAGACACTGCATCCATAGAGCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 25/25
genomic

MO
5' ATGGCTCTTTGGATGCAGTGTCTGC 3' |||||||| |||||||||||||||| 3' TACCGAGATACCTACGTCACAGACG 5' 5' ATGGCTCTATGGATGCAGTGTCTGC 3' ||||||||||||||||||||||||| 3' TACCGAGATACCTACGTCACAGACG 5' 5' ATGGCTCTATGGATGCAGTGTCTGC 3' ||||||||||||||||||||||||| 3' TACCGAGATACCTACGTCACAGACG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr4L:15808386..15808410 25/25 Antisense target ins.L
chr4S:7239665..7239689 25/25 Antisense target ins.S
chr3L:106816368..106816392 22/25 Antisense off-target LOC108711483
chr2S:134594073..134594097 21/25 Antisense off-target exosc8.S
chr2S:134594073..134594097 21/25 Sense off-target supt20h.S
tropicalis 10.0 Chr4:22184263..22184287 24/25 Antisense target ins
Publications
First: MicroRNAs are critical regulators of tuberous sclerosis complex and mTORC1 activity in the size control of the Xenopus kidney., Proc Natl Acad Sci U S A 2014                                                            
Most recent:
View All Papers