Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18319811

Morpholino Name: marveld3 MO1
Synonyms: MD3A
Target mRNA: marveld3

Morpholino Type: uncategorized morpholino
Sequence: 5' AGACCCAAATCTTCCTTTTGTTCCC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25
genomic

MO
5' GGGAACAAAAGGAAGATTTGGGTGA 3' ||||||||||||||||||||||| 3' CCCTTGTTTTCCTTCTAAACCCAGA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 Scaffold97:150709..150733 23/25 Antisense target marveld3.L
chr4L:133895285..133895309 22/25 Antisense off-target plxnb1.L
chr4L:63516711..63516735 21/25 Sense off-target slc9a5.L
chr2S:64764647..64764671 21/25 unknown
tropicalis 10.0 Chr1:150835404..150835428 21/25 unknown
Chr4:96168118..96168142 21/25 unknown
Publications
First: MarvelD3 regulates the c-Jun N-terminal kinase pathway during eye development in Xenopus., Biol Open 2016                            
Most recent: Control of neural crest induction by MarvelD3-mediated attenuation of JNK signalling., Sci Rep 2018                                
View All Papers