Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18328537

Morpholino Name: fst MO3
Synonyms:
Target mRNA: fst

Morpholino Type: translation blocking morpholino (5' UTR)
Sequence: 5' AGAAGCAGCAGAGTCTCAAGTGGAG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 21/25 21/25
genomic

MO
5' CTCCACTTGAGACTCTGCTGCTTCT 3' ||||||||||||||||||||||||| 3' GAGGTGAACTCTGAGACGACGAAGA 5' 5' CTCCACTTGAGACTCTGCTCGTCCC 3' ||||||||||||||||||| | | 3' GAGGTGAACTCTGAGACGACGAAGA 5' 5' CTCCACTTGAGACTCTGCTCGTCCC 3' ||||||||||||||||||| | | 3' GAGGTGAACTCTGAGACGACGAAGA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1L:209714019..209714043 21/25 Antisense target fst.L
Chr1S:181156488..181156512 21/25 Antisense target fst.S
Chr2S:59182888..59182912 21/25 Antisense off-target srpk1.S
Chr6L:57806512..57806536 21/25 Sense off-target myrip.L
Chr7S:19072067..19072091 21/25 Antisense off-target sema4g.S
Chr8S:1888556..1888580 21/25 Antisense off-target LOC108699714
Chr1S:76572680..76572704 21/25 unknown
Chr3L:67683347..67683371 21/25 unknown
Chr4S:14302465..14302489 21/25 unknown
Chr5L:36620037..36620061 21/25 unknown
Chr5S:115585388..115585412 21/25 unknown
Chr7L:130369479..130369503 21/25 unknown
Chr8L:33377108..33377132 21/25 unknown
tropicalis 10.0 Chr1:192430848..192430872 25/25 Antisense target fst
Chr8:7222911..7222935 22/25 unknown
Publications
First: Depletion of three BMP antagonists from Spemann''s organizer leads to a catastrophic loss of dorsal structures., Dev Cell 2005                            
Most recent: Noggin is required for first pharyngeal arch differentiation in the frog Xenopus tropicalis., Dev Biol 2017                  
View All Papers