Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18330991

Morpholino Name: XPhyH like MO1
Synonyms: Xelaev18038696m
Target mRNA: phyhdlb

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' TCATGGTTCAGAGAGTGGATTTTCT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/25
genomic

MO
5' AGAAAATCCACTCCATAAACCATGA 3' ||||||||||||| | |||||||| 3' TCTTTTAGGTGAGAGACTTGGTACT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8L:23411331..23411355 22/25 Antisense target phyhdlb.L
chr8L:23293822..23293846 24/25 Antisense off-target phyhdlc.1.L
chr8L:23466992..23467016 23/25 Antisense off-target phyhdla.1.L
chr2L:127072335..127072359 21/25 Sense off-target mzt1.L
Publications
First: Expression analysis of XPhyH-like during development and tail regeneration in Xenopus tadpoles: possible role of XPhyH-like expressing immune cells in impaired tail regenerative ability., Biochem Biophys Res Commun 2013                
Most recent:
View All Papers