Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18335654

Morpholino Name: ins3 MO1
Synonyms: insulin 3
Target mRNA: ins

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' TGCCCAATCACCTTGTGCCATATTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr7L:106175579..106175603 25/25 Antisense off-target XB5961731.L [provisional:ins]
chr2L:69356877..69356901 21/25 Sense off-target rsbn1.L
chr2L:42317677..42317701 21/25 unknown
chr6S:105899837..105899861 21/25 unknown
tropicalis 10.0 Chr2:123017832..123017856 22/25 Antisense off-target gpc6
Chr2:123017832..123017856 22/25 Antisense off-target Xetrov107017242m.g
Chr7:110971302..110971326 22/25 Antisense off-target LOC100494294
Chr7:110971302..110971326 22/25 Antisense off-target Xetrov107050489m.g
Publications
First: Insulin-like factor regulates neural induction through an IGF1 receptor-independent mechanism., Sci Rep 2015                                                    
Most recent:
View All Papers