Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18335655

Morpholino Name: ins3 MO2
Synonyms: insulin 3
Target mRNA: ins

Morpholino Type: splice blocking morpholino
Sequence: 5' TGCAAGAAATGAAAGTTACCTTTTT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr1L:65044203..65044227 21/25 Antisense off-target sgms2.L
chr5L:88192366..88192390 21/25 Antisense off-target htr1e.L
chr5S:89699610..89699634 21/25 Sense off-target gnb4.S
chr8L:8557657..8557681 22/25 unknown
chr5L:85242548..85242572 21/25 unknown
tropicalis 10.0 Chr7:110971141..110971165 25/25 Antisense off-target LOC100494294
Chr7:110971141..110971165 25/25 Antisense off-target Xetrov107050489m.g
Chr1:27900958..27900982 21/25 Antisense off-target cc2d2a
Chr1:66102672..66102696 21/25 Sense off-target LOC100145817
Chr3:100440306..100440330 21/25 Sense off-target nedd4
Chr8:38750856..38750880 21/25 Sense off-target LOC100496398
Chr8:94546215..94546239 21/25 Sense off-target psmc6
Chr1:3429736..3429760 21/25 unknown
Chr5:136950825..136950849 21/25 unknown
Publications
First: Insulin-like factor regulates neural induction through an IGF1 receptor-independent mechanism., Sci Rep 2015                                                    
Most recent:
View All Papers