Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18335933

Morpholino Name: nos1 MO1
Synonyms: nNOS
Target mRNA: nos1

Morpholino Type: uncategorized morpholino
Sequence: 5' TGGCTAAAAGAACACAGGACATCAA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' ATGATGTCCTGTGTTCTTTTAGCCA 3' |||||||||||||||||||||||| 3' AACTACAGGACACAAGAAAATCGGT 5' 5' TTGATGTCCTGTGTTCTTTTAGCCA 3' ||||||||||||||||||||||||| 3' AACTACAGGACACAAGAAAATCGGT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr1L:165710155..165710179 25/25 Antisense target nos1.L
chr4L:95109171..95109195 22/25 Antisense off-target evi5.L
chr6S:12013725..12013749 21/25 Antisense off-target esyt2.S
chr1S:143365121..143365145 21/25 unknown
chr4L:41518891..41518915 21/25 unknown
chr5S:102026029..102026053 21/25 unknown
tropicalis 10.0 Chr1:164882641..164882665 24/25 Antisense target nos1
Publications
First: The extreme anterior domain is an essential craniofacial organizer acting through Kinin-Kallikrein signaling., Cell Rep 2014                              
Most recent: The role of nitric oxide during embryonic wound healing., BMC Genomics 2019                                                
View All Papers