Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18338692

Morpholino Name: nosip MO1
Synonyms:
Target mRNA: nosip

Morpholino Type: uncategorized morpholino
Sequence: 5' TACAGTTTTTCCCATGCCTTGTCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' ATGACAAGGCATGGGAAAAACTGTA 3' ||||||||||||||||||||||||| 3' TACTGTTCCGTACCCTTTTTGACAT 5' 5' ATGACAAGGCATGGGAAAAACTGTA 3' ||||||||||||||||||||||||| 3' TACTGTTCCGTACCCTTTTTGACAT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7S:96772989..96773013 25/25 Antisense target nosip.S
Chr7L:116262595..116262619 23/25 Antisense off-target LOC121395625
Chr8L:7447655..7447679 21/25 Sense off-target LOC108698218
Chr2S:21969816..21969840 21/25 Sense off-target MGC80765
Chr3L:83280498..83280522 21/25 Sense off-target atxn7l1.L
Chr8S:73963982..73964006 22/25 unknown
Chr4S:28934112..28934136 21/25 unknown
Chr6S:55710119..55710143 21/25 unknown
Chr7L:55000011..55000035 21/25 unknown
tropicalis 10.0 Chr7:110555930..110555954 25/25 Antisense target nosip
Chr2:75172733..75172757 21/25 Antisense off-target cyb5r1
Chr3:123640014..123640038 22/25 unknown
Publications
First: Developmental neurogenesis in mouse and Xenopus is impaired in the absence of Nosip., Dev Biol 2017                    
Most recent: Nosip functions during vertebrate eye and cranial cartilage development., Dev Dyn 2018                  
View All Papers