Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18338694

Morpholino Name: rbp1 MO2
Synonyms:
Target mRNA: rbp1

Morpholino Type: uncategorized morpholino
Sequence: 5' CATGTCTGCTGGGCGAATGAGT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 20/22 20/22
genomic

MO
5' ACTCACTCACCCAGCAGACATG 3' ||||| || ||||||||||||| 3' TGAGTAAGCGGGTCGTCTGTAC 5' 5' ACTTACTCGCCCAGCAGACATG 3' ||| | |||||||||||||||| 3' TGAGTAAGCGGGTCGTCTGTAC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr5L:138134487..138134508 20/22 Antisense target rbp1.L
Chr5S:115980774..115980795 20/22 Antisense target rbp1.S
Chr3L:103604624..103604645 20/22 Sense off-target thsd4.L
Chr3L:67252489..67252510 20/22 Sense off-target trhde.L
Chr7S:58537663..58537684 18/22 Sense off-target LOC108697229
Chr4L:31738147..31738168 19/22 unknown
Chr3L:76215306..76215327 18/22 unknown
tropicalis 10.0 Chr7:37591159..37591180 19/22 Sense off-target plce1
Publications
First: Developmental neurogenesis in mouse and Xenopus is impaired in the absence of Nosip., Dev Biol 2017                    
Most recent: Retinol binding protein 1 affects Xenopus anterior neural development via all-trans retinoic acid signaling., Dev Dyn 2021                  
View All Papers