Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18338900

Morpholino Name: otx1 MO1
Synonyms:
Target mRNA: otx1

Morpholino Type: uncategorized morpholino
Sequence: 5' TAGGACATCATGCTCAAGGCTGGAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 25/25
genomic

MO
5' GTCCAGCCTTGAGCATGATGTCATA 3' ||||||||||||||||||||| || 3' TAGGTCGGAACTCGTACTACAGGAT 5' 5' ATCCAGCCTTGAGCATGATGTCCTA 3' ||||||||||||||||||||||||| 3' TAGGTCGGAACTCGTACTACAGGAT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr5L:30930683..30930707 25/25 Antisense target otx1.L
chr4L:31751446..31751470 21/25 Sense off-target fto.L
tropicalis 10.0 Chr5:32917137..32917161 23/25 Antisense target otx1
Chr2:84888246..84888270 21/25 unknown
Publications
First: High-throughput analysis reveals novel maternal germline RNAs crucial for primordial germ cell preservation and proper migration., Development 2017                                                                                          
Most recent:
View All Papers