Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18339088

Morpholino Name: hmmr MO1
Synonyms:
Target mRNA: hmmr

Morpholino Type: uncategorized morpholino
Sequence: 5' GCTGGAGCCCGCGATGCTTTCTTTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GAAAGAAAGCATCGCGGGCTCCAGC 3' ||||||||||||||||||||||||| 3' CTTTCTTTCGTAGCGCCCGAGGTCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3L:17377030..17377054 25/25 Antisense target hmmr.L
Publications
First: hmmr mediates anterior neural tube closure and morphogenesis in the frog Xenopus., Dev Biol 2017                        
Most recent:
View All Papers