Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18339089

Morpholino Name: hmmr MO2
Synonyms:
Target mRNA: hmmr

Morpholino Type: uncategorized morpholino
Sequence: 5' AGCCTTGGGAAATGACATTTTGGCT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' AGCCAAAATGTCTTTTCCCAAGGCT 3' |||||||||||| |||||||||||| 3' TCGGTTTTACAGTAAAGGGTTCCGA 5' 5' AGCCAAAATGTCATTTCCCAAGGCT 3' ||||||||||||||||||||||||| 3' TCGGTTTTACAGTAAAGGGTTCCGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3L:17377008..17377032 25/25 Antisense target hmmr.L
chr4L:80111297..80111321 22/25 Antisense off-target hectd3.L
chr5L:5248668..5248692 21/25 Antisense off-target msh2.L
tropicalis 10.0 Chr3:25071913..25071937 24/25 Antisense target hmmr
Chr2:161450810..161450834 21/25 Sense off-target dync2h1
Chr9:68503867..68503891 21/25 Antisense off-target bbs5
Chr2:149694559..149694583 21/25 unknown
Chr5:42857128..42857152 21/25 unknown
Chr7:61532817..61532841 21/25 unknown
Publications
First: hmmr mediates anterior neural tube closure and morphogenesis in the frog Xenopus., Dev Biol 2017                        
Most recent:
View All Papers