Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18339090

Morpholino Name: vangl2 MO5
Synonyms:
Target mRNA: vangl2

Morpholino Type: uncategorized morpholino
Sequence: 5' ACTGGGAATCATTGTCCATGTTTTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 24/25 25/25
genomic

MO
5' GAAAACATGGACAACGACTCCCAGT 3' |||||||||||||| || ||||||| 3' CTTTTGTACCTGTTACTAAGGGTCA 5' 5' GAAAACATGGACAACGATTCCCAGT 3' |||||||||||||| |||||||||| 3' CTTTTGTACCTGTTACTAAGGGTCA 5' 5' GAAAACATGGACAATGATTCCCAGT 3' ||||||||||||||||||||||||| 3' CTTTTGTACCTGTTACTAAGGGTCA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8S:94049592..94049616 25/25 Antisense target vangl2.S
chr8L:112211820..112211844 24/25 Antisense target vangl2.L
chr1L:117452660..117452684 21/25 Sense off-target focad.L
chr1S:121319823..121319847 21/25 Sense off-target LOC108705073 [provisional:myo18b]
chr7L:57670470..57670494 21/25 Antisense off-target paox.L
chr6L:146817959..146817983 22/25 unknown
chr6L:117462736..117462760 21/25 unknown
tropicalis 10.0 Chr8:137136566..137136590 23/25 Antisense target vangl2
Chr10:47006209..47006233 21/25 Sense off-target myocd
Chr10:47006209..47006233 21/25 Antisense off-target LOC105945265
Chr1:92567879..92567903 21/25 unknown
Publications
First: hmmr mediates anterior neural tube closure and morphogenesis in the frog Xenopus., Dev Biol 2017                        
Most recent:
View All Papers