Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18374208

Morpholino Name: ift46 MO1
Synonyms:
Target mRNA: ift46

Morpholino Type: uncategorized morpholino
Sequence: 5' GATGTGTTTCTGCCTCTTCCATCC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/24 22/24
genomic

MO
5' GGATGGAGGAGGCAGAAACACATG 3' ||||||| ||||||||||||||| 3' CCTACCTTCTCCGTCTTTGTGTAG 5' 5' GGATGGAAGAGGCAGAAACAGATG 3' |||||||||||||||||||| || 3' CCTACCTTCTCCGTCTTTGTGTAG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 Scaffold80:640089..640112 22/24 Antisense target ift46.S
chr7L:73594173..73594196 22/24 Antisense target ift46.L
chr1S:65516174..65516197 20/24 Antisense off-target grid2.S
chr3S:30988035..30988058 20/24 Antisense off-target tacr1.S
chr9_10L:106320472..106320495 20/24 Sense off-target glis2.L
chr9_10S:94710398..94710421 20/24 Sense off-target glis2.S
chr1L:188704420..188704443 20/24 unknown
chr6L:81207841..81207864 20/24 unknown
chr9_10S:38406829..38406852 20/24 unknown
tropicalis 10.0 Chr1:192021059..192021082 20/24 Sense off-target arl15
Chr1:192021104..192021127 20/24 Sense off-target arl15
Chr1:192021149..192021172 20/24 Sense off-target arl15
Chr1:192021194..192021217 20/24 Sense off-target arl15
Chr1:61092566..61092589 20/24 Antisense off-target naa15
Chr1:77020211..77020234 20/24 Antisense off-target grid2
Chr5:106480347..106480370 20/24 Antisense off-target xxylt1
Chr1:192020924..192020947 20/24 Sense off-target arl15
Chr1:192021014..192021037 20/24 Sense off-target arl15
Chr4:42387484..42387507 20/24 unknown
Chr1:178657868..178657891 20/24 unknown
Chr1:185358675..185358698 20/24 unknown
Publications
First: IFT46 plays crucial roles in craniofacial and cilia development., Biochem Biophys Res Commun 2016              
Most recent:
View All Papers