Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18374231

Morpholino Name: rras MO1
Synonyms:
Target mRNA: rras

Morpholino Type: translation blocking morpholino
Sequence: 5' GCTCCTTGGAACTCATAGTCGCTGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr7S:77820079..77820103 25/25 Antisense off-target LOC108697778 [provisional:rras2]
chr7L:105915700..105915724 24/25 Antisense off-target LOC108696729 [provisional:rras2]
Publications
First: miR-34/449 control apical actin network formation during multiciliogenesis through small GTPase pathways., Nat Commun 2015                  
Most recent:
View All Papers