Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18374337

Morpholino Name: ern1 MO2
Synonyms:
Target mRNA: ern1

Morpholino Type: uncategorized morpholino
Sequence: 5' AAGAGAACCGCCAGAGGCGCCATGT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' ACATGGCGCCTCTGGCGGTTCTCTT 3' ||||||||||||||||||||||||| 3' TGTACCGCGGAGACCGCCAAGAGAA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr9_10L:44033874..44033898 25/25 Antisense target ern1.L
chr3S:78726489..78726513 21/25 Sense off-target met.S
Publications
First: IRE1α is essential for Xenopus pancreas development., J Biomed Res 2014                
Most recent: IRE1α knockdown rescues tunicamycin-induced developmental defects and apoptosis in Xenopus laevis., J Biomed Res 2014          
View All Papers