Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18374358

Morpholino Name: tcf21 MO4
Synonyms:
Target mRNA: tcf21

Morpholino Type: translation blocking morpholino (5' UTR)
Sequence: 5' GATCAAGGTGTGACTGAATGCAATA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/25 25/25 24/25
genomic

MO
5' TGTTGTATTCAGTCACACCTTGGTC 3' | ||| |||||||||||||||| || 3' ATAACGTAAGTCAGTGTGGAACTAG 5' 5' TATTGCATTCAGTCACACCTTGATC 3' ||||||||||||||||||||||||| 3' ATAACGTAAGTCAGTGTGGAACTAG 5' 5' TATTGCACTCAGTCACACCTTGATC 3' ||||||| ||||||||||||||||| 3' ATAACGTAAGTCAGTGTGGAACTAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr5L:71732784..71732808 25/25 Antisense target tcf21.L
Scaffold49:1211116..1211140 24/25 Antisense target tcf21.S
Scaffold97:100101..100125 21/25 unknown
tropicalis 10.0 Chr5:71125533..71125557 22/25 Antisense target tcf21
Chr2:135641134..135641158 22/25 unknown
Publications
First: Tcf21 regulates the specification and maturation of proepicardial cells., Development 2013                                  
Most recent: Morpholinos Do Not Elicit an Innate Immune Response during Early Xenopus Embryogenesis., Dev Cell 2019          
View All Papers