Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18374388

Morpholino Name: hes5.4 MO1
Synonyms: hes8 MO1
Target mRNA: hes5.4

Morpholino Type: translation blocking morpholino
Sequence: 5' AGAAGCCATTTATTGCACTCTGTCT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25
genomic

MO
5' AGACAGAGTGCAATAAATGGCTTCT 3' ||||||||||||||||||||||||| 3' TCTGTCTCACGTTATTTACCGAAGA 5' 5' AGACAGAGTACAATAAATGGCTTCT 3' ||||||||| ||||||||||||||| 3' TCTGTCTCACGTTATTTACCGAAGA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr7L:93672262..93672286 25/25 Antisense target hes5.4.L
chr7S:67814931..67814955 24/25 Antisense target hes5.4.S
chr2L:35037984..35038008 21/25 Sense off-target smyd4.L
chr2L:35037984..35038008 21/25 Antisense off-target serpinf1.L
chr4S:85250054..85250078 21/25 Antisense off-target kcnt2.S
chr5L:113211855..113211879 22/25 unknown
chr1S:105499566..105499590 21/25 unknown
chr9_10S:44125564..44125588 21/25 unknown
tropicalis 10.0 Chr6:27656565..27656589 21/25 Sense off-target plxdc2
Chr7:29201925..29201949 21/25 Sense off-target trim8
Chr1:186621794..186621818 22/25 unknown
Chr2:104427644..104427668 21/25 unknown
Chr2:74271635..74271659 21/25 unknown
Chr4:146827792..146827816 21/25 unknown
Chr8:104269689..104269713 21/25 unknown
Publications
First: Six1 and Eya1 both promote and arrest neuronal differentiation by activating multiple Notch pathway genes., Dev Biol 2017                              
Most recent:
View All Papers