Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18375584

Morpholino Name: casp9 MO3
Synonyms: CASP9MOEI
Target mRNA: casp9

Morpholino Type: uncategorized morpholino
Sequence: 5' GACAATGGCAGAAATTTACCTCCGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GCGGAGGTAAATTTCTGCCATTGTC 3' ||||||||||||||||||||||||| 3' CGCCTCCATTTAAAGACGGTAACAG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
tropicalis 10.0 Chr7:129464848..129464872 25/25 Antisense target casp9
Publications
First: Caspase-9 has a nonapoptotic function in Xenopus embryonic primitive blood formation., J Cell Sci 2017                              
Most recent:
View All Papers