Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18375587

Morpholino Name: pitx2 MO2
Synonyms: pitx2c ATG MO
Target mRNA: pitx2

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' GTAAAGGGTCTTTCATAGAGTTCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 24/25 24/25
genomic

MO
5' ATGAACTCTATGAAAGAGCCTTTAC 3' ||||||||||||||||| ||||||| 3' TACTTGAGATACTTTCTGGGAAATG 5' 5' ATGAACTCTATGAAAGAGCCTTTAC 3' ||||||||||||||||| ||||||| 3' TACTTGAGATACTTTCTGGGAAATG 5' 5' ATGAACTCTATGAAAGAGCCTTTAC 3' ||||||||||||||||| ||||||| 3' TACTTGAGATACTTTCTGGGAAATG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr1L:61292009..61292033 24/25 Antisense target pitx2.L
chr1S:56181755..56181779 24/25 Antisense target pitx2.S
Scaffold47:955230..955254 21/25 Antisense off-target LOC108704748
tropicalis 10.0 Chr1:68329802..68329826 24/25 Antisense target pitx2
Publications
First: Stomach curvature is generated by left-right asymmetric gut morphogenesis., Development 2017                        
Most recent: Single-minded 2 is required for left-right asymmetric stomach morphogenesis., Development 2021                  
View All Papers