Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18385573

Morpholino Name: ism1 MO2
Synonyms:
Target mRNA: ism1

Morpholino Type: splice blocking morpholino
Sequence: 5' TGTATGTGGAATGGACTAACCTGTA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 21/25
genomic

MO
5' GACAAGTTATTCCATTCCACATATA 3' ||| |||| ||||||||||||| | 3' ATGTCCAATCAGGTAAGGTGTATGT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr5L:25499684..25499708 25/25 Antisense target ism1.L
chr5L:25499705..25499729 25/25 Antisense target ism1.L
chr5L:25499815..25499839 24/25 Antisense target ism1.L
chr5L:25499857..25499881 24/25 Antisense target ism1.L
chr5L:25499878..25499902 24/25 Antisense target ism1.L
chr5L:25499920..25499944 24/25 Antisense target ism1.L
chr5L:25499941..25499965 24/25 Antisense target ism1.L
chr5L:25499983..25500007 24/25 Antisense target ism1.L
chr5L:25500025..25500049 24/25 Antisense target ism1.L
chr5L:25500072..25500096 24/25 Antisense target ism1.L
chr5L:25499663..25499687 24/25 Antisense target ism1.L
chr5L:25500160..25500184 22/25 Antisense target ism1.L
chr5L:25500137..25500161 21/25 Antisense target ism1.L
chr9_10L:17952396..17952420 21/25 Antisense off-target LOC108702054
chr3L:55493476..55493500 21/25 Sense off-target nell2.L
Publications
First: Identification of Isthmin 1 as a Novel Clefting and Craniofacial Patterning Gene in Humans., Genetics 2018                    
Most recent:
View All Papers