Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18386268

Morpholino Name: ifnar2.1 and ifnar2.2 MO1
Synonyms:
Target mRNA: ifnar2.1

Morpholino Type: uncategorized morpholino
Sequence: 5' CAGCAGAAGACACAGCCCTGCCATG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25
genomic

MO
5' CATGGCAGGGCTGTGTCTGCTGCTG 3' |||||||||||||||||| |||||| 3' GTACCGTCCCGACACAGAAGACGAC 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr2S:19809641..19809665 25/25 Antisense off-target ifnar2.2.S
chr2S:19845777..19845801 25/25 Antisense off-target ifnar2.S
chr2L:14031169..14031193 22/25 Antisense off-target ifnar2.2.L
chr3S:57304321..57304345 21/25 Sense off-target oaz2.S
chr4S:77300760..77300784 21/25 Antisense off-target bcar3.S
Scaffold35:1578472..1578496 21/25 unknown
chr3S:22074451..22074475 21/25 unknown
tropicalis 10.0 Chr2:14778805..14778829 24/25 Antisense target ifnar2.1
Chr2:14814814..14814838 25/25 Antisense off-target ifnar2.2
Chr9:39014450..39014474 22/25 Sense off-target rbfox1
Publications
First: Differentiation-dependent antiviral capacities of amphibian (Xenopus laevis) macrophages., J Biol Chem 2018  
Most recent:
View All Papers