Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-18386269

Morpholino Name: ifnlr1 MO1
Synonyms:
Target mRNA: ifnlr1

Morpholino Type: uncategorized morpholino
Sequence: 5' GCCCAGGTGAACCAGACAGACATAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 24/25
genomic

MO
5' ATATGTCTGTCTGGTTCACTTGGGC 3' ||||||||||||||||||| ||||| 3' TATACAGACAGACCAAGTGGACCCG 5' 5' ATATGTCTGTCTGCTTCACCTGGGC 3' ||||||||||||| ||||||||||| 3' TATACAGACAGACCAAGTGGACCCG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 Scaffold110:213076..213100 24/25 Antisense target ifnlr1.L
Scaffold43:1283610..1283634 25/25 Antisense off-target LOC108704662 [provisional:ifnlr1]
Scaffold110:213076..213100 24/25 Sense off-target LOC108705445
chr2S:108406701..108406725 21/25 unknown
chr3S:52069612..52069636 21/25 unknown
tropicalis 10.0 Chr2:80770808..80770832 24/25 Antisense target ifnlr1
Publications
First: Differentiation-dependent antiviral capacities of amphibian (Xenopus laevis) macrophages., J Biol Chem 2018  
Most recent:
View All Papers