Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-19756358

Morpholino Name: myo1d MO1
Synonyms:
Target mRNA: myo1d

Morpholino Type: uncategorized morpholino
Sequence: 5' TGCAGCCCCTCTTGTTCCGCCATGT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' ACATGGCGGAACAAGAGGGGCTACA 3' |||||||||||||||||||||| || 3' TGTACCGCCTTGTTCTCCCCGACGT 5' 5' ACATGGCGGAACAAGAGGGGCTGCA 3' ||||||||||||||||||||||||| 3' TGTACCGCCTTGTTCTCCCCGACGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr9_10L:5802370..5802394 25/25 Antisense target myo1d.L
chr9_10S:5331346..5331370 24/25 Antisense off-target LOC108702550 [provisional:myo1d]
chr5S:115980303..115980327 22/25 Sense off-target trappc12.S
tropicalis 10.0 Chr10:17637727..17637751 24/25 Antisense target myo1d
Chr9:91108058..91108082 21/25 Antisense off-target slc35f5
Chr9:91108058..91108082 21/25 Antisense off-target Xetrov107063412m.g
Chr5:12077215..12077239 21/25 unknown
Chr5:12077610..12077634 21/25 unknown
Publications
First: A Conserved Role of the Unconventional Myosin 1d in Laterality Determination., Curr Biol 2018                  
Most recent:
View All Papers