Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-22063715

Morpholino Name: itgbl1 MO1
Synonyms:
Target mRNA: itgbl1

Morpholino Type: uncategorized morpholino
Sequence: 5' AGTAGGGAAGATATACAGACCTGCA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/25 25/25 23/25
genomic

MO
5' TGCAGGTCTGTATTTTTTTCCTACT 3' ||||||||||||| | || |||||| 3' ACGTCCAGACATATAGAAGGGATGA 5' 5' TGCAGGTCTGTATATCTTCCCTACT 3' ||||||||||||||||||||||||| 3' ACGTCCAGACATATAGAAGGGATGA 5' 5' TGCAGGTCTGTATAGCTTCCTTACT 3' |||||||||||||| ||||| |||| 3' ACGTCCAGACATATAGAAGGGATGA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr2L:119222621..119222645 25/25 Antisense target itgbl1.L
chr2S:101726105..101726129 23/25 Antisense target itgbl1.S
chr7L:89634927..89634951 21/25 Antisense off-target LOC101730276.L
tropicalis 10.0 Chr2:120183851..120183875 22/25 Antisense target itgbl1
Publications
First: ITGBL1 modulates integrin activity to promote cartilage formation and protect against arthritis., Sci Transl Med 2018    
Most recent:
View All Papers