Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-22063820

Morpholino Name: dkk1 MO1
Synonyms:
Target mRNA: dkk1

Morpholino Type: uncategorized morpholino
Sequence: 5' CATGTTGCTGCCCATTCCTCTGTCC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GGACAGAGGAATGGGCAGCAACATG 3' ||||||||||||||||||||||||| 3' CCTGTCTCCTTACCCGTCGTTGTAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr7S:6378668..6378692 25/25 Antisense target dkk1.S
chr3S:60383277..60383301 22/25 Antisense off-target alpk3.S
chr4S:114017147..114017171 22/25 Antisense off-target foxp1.S
Scaffold27:1758272..1758296 21/25 unknown
chr1S:122753009..122753033 21/25 unknown
chr2S:156348308..156348332 21/25 unknown
tropicalis 10.0 Chr6:60514643..60514667 21/25 unknown
Publications
First: The Wnt inhibitor Dkk1 is required for maintaining the normal cardiac differentiation program in Xenopus laevis., Dev Biol 2019                                    
Most recent:
View All Papers