Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-22201076

Morpholino Name: XMAP215 MO
Synonyms:
Target mRNA: ckap5

Morpholino Type: splice blocking morpholino
Sequence: 5' GGCTTTCCAAACCTACCATGAAACA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 25/25 25/25
genomic

MO
5' TATTTCCTGGTAGGTTTGGAAAGCC 3' | |||| |||||||||||||||||| 3' ACAAAGTACCATCCAAACCTTTCGG 5' 5' TGTTTCATGGTAGGTTTGGAAAGCC 3' ||||||||||||||||||||||||| 3' ACAAAGTACCATCCAAACCTTTCGG 5' 5' TGTTTCATGGTAGGTTTGGAAAGCC 3' ||||||||||||||||||||||||| 3' ACAAAGTACCATCCAAACCTTTCGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr4L:8836656..8836680 25/25 Antisense target ckap5.L
chr4S:14266880..14266904 25/25 Antisense target ckap5.S
Scaffold33:2064226..2064250 22/25 unknown
tropicalis 10.0 Chr4:12901765..12901789 23/25 Antisense target ckap5
Chr1:129852472..129852496 23/25 Antisense off-target klf9
Chr1:103227982..103228006 21/25 Sense off-target arhgef18
Publications
First: XMAP215 promotes microtubule-F-actin interactions to regulate growth cone microtubules during axon guidance in Xenopuslaevis., J Cell Sci 2019                        
Most recent:
View All Papers