Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-23619059

Morpholino Name: letm1 MO1
Synonyms:
Target mRNA: letm1

Morpholino Type: splice blocking morpholino (E1-I1)
Sequence: 5' ATGACACACAAGTGCTACTTACCCT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25
genomic

MO
5' AGGGTAAGTAGCACTTGTGTGTCAT 3' ||||||||||||||||||||||||| 3' TCCCATTCATCGTGAACACACAGTA 5' 5' AGGGTAAGTATCACTTGTGTGTCAT 3' |||||||||| |||||||||||||| 3' TCCCATTCATCGTGAACACACAGTA 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr1L:13075441..13075465 25/25 Antisense target letm1.L
chr1S:12251407..12251431 24/25 Antisense target letm1.S
chr1L:80527091..80527115 22/25 Antisense off-target hsd17b13.L
chr2S:92355828..92355852 21/25 unknown
tropicalis 10.0 Chr8:111349864..111349888 21/25 Antisense off-target c15orf41
Publications
First: Wolf-Hirschhorn Syndrome-Associated Genes Are Enriched in Motile Neural Crest Cells and Affect Craniofacial Development in Xenopus laevis., Front Physiol 2019                                            
Most recent:
View All Papers