Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-23619060

Morpholino Name: nsd2 MO1
Synonyms: whsc1 MO
Target mRNA: nsd2

Morpholino Type: splice blocking morpholino
Sequence: 5' TGCGTTTTCATGTTTACCAGAGTCT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 25/25
genomic

MO
5' AGACTCTGGTAAACATGAAAACACA 3' |||||||||||||||||||||| || 3' TCTGAGACCATTTGTACTTTTGCGT 5' 5' AGACTCTGGTAAACATGAAAACGCA 3' ||||||||||||||||||||||||| 3' TCTGAGACCATTTGTACTTTTGCGT 5' 5' AGACTCTGGTAAACATGAAAACGCA 3' ||||||||||||||||||||||||| 3' TCTGAGACCATTTGTACTTTTGCGT 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr1L:13134689..13134713 25/25 Antisense target nsd2.L
chr1S:12298283..12298307 25/25 Antisense target nsd2.S
chr2L:63952525..63952549 22/25 Antisense off-target elk4.L
Scaffold30:447284..447308 21/25 Sense off-target kcnj16.L
chr1S:18779969..18779993 21/25 Sense off-target LOC108706548 [provisional:ldb2]
chr2S:53971311..53971335 21/25 unknown
tropicalis 10.0 Chr1:21067242..21067266 24/25 Antisense target nsd2
Chr3:27266355..27266379 21/25 unknown
Publications
First: Wolf-Hirschhorn Syndrome-Associated Genes Are Enriched in Motile Neural Crest Cells and Affect Craniofacial Development in Xenopus laevis., Front Physiol 2019                                            
Most recent:
View All Papers