Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-23619106

Morpholino Name: pnhd MO4
Synonyms: PhSpMo
Target mRNA: pnhd

Morpholino Type: splice blocking morpholino
Sequence: 5' CCTGTTCATCACGCTACCATCTAAA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 23/25
genomic

MO
5' TTTAGATGATAGCGTGATGAACAGG 3' |||||||| |||||||||||||||| 3' AAATCTACCATCGCACTACTTGTCC 5' 5' TTTAGATGGTAGCGTGATGAACAGG 3' ||||||||||||||||||||||||| 3' AAATCTACCATCGCACTACTTGTCC 5' 5' TTTAGATGGTAGTGTGATTAACAGG 3' |||||||||||| ||||| |||||| 3' AAATCTACCATCGCACTACTTGTCC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1L:101959092..101959116 25/25 Antisense target pnhd.L
chr1S:89990776..89990800 23/25 Antisense target pnhd.S
chr3S:71136430..71136454 21/25 Sense off-target ptpn12.S
chr5L:115491335..115491359 21/25 Sense off-target gpr171.L
tropicalis 10.0 Chr1:104459943..104459967 24/25 Antisense target pnhd
Chr1:104459943..104459967 24/25 Sense off-target LOC116412038
Publications
First: Pinhead signaling regulates mesoderm heterogeneity via the FGF receptor-dependent pathway., Development 2020  
Most recent:
View All Papers