Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-23619107

Morpholino Name: pnhd MO5
Synonyms: Pnhd MOatg
Target mRNA: pnhd

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' ACAAGAAAAGATGTTCCATGTCTG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/24 24/24 22/24
genomic

MO
5' CAGACATGGAACATCTTTTCTTGG 3' ||||||||||||||||||||||| 3' GTCTGTACCTTGTAGAAAAGAACA 5' 5' CAGACATGGAACATCTTTTCTTGT 3' |||||||||||||||||||||||| 3' GTCTGTACCTTGTAGAAAAGAACA 5' 5' CAGACATGGCACATCTTTTCTTGG 3' ||||||||| ||||||||||||| 3' GTCTGTACCTTGTAGAAAAGAACA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1L:101958834..101958857 24/24 Antisense target pnhd.L
chr1S:89990488..89990511 22/24 Antisense target pnhd.S
chr3S:68557717..68557740 20/24 Antisense off-target grm3.S
chr6S:56716276..56716299 20/24 Sense off-target LOC108720028 [provisional:mocos]
chr5L:65153782..65153805 21/24 unknown
chr6L:111192136..111192159 21/24 unknown
chr1L:212610657..212610680 20/24 unknown
tropicalis 10.0 Chr1:104459700..104459723 23/24 Antisense target pnhd
Chr1:104459700..104459723 23/24 Sense off-target LOC116412038
Chr3:81085889..81085912 20/24 Antisense off-target grm3
Chr2:52382729..52382752 20/24 unknown
Publications
First: Pinhead signaling regulates mesoderm heterogeneity via the FGF receptor-dependent pathway., Development 2020  
Most recent:
View All Papers