Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-23622737

Morpholino Name: sf3b4 MO3
Synonyms: SF3B4MO
Target mRNA: sf3b4

Morpholino Type: uncategorized morpholino
Sequence: 5' GCCATAACCTGTGAGGAAAAAGAGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GCTCTTTTTCCTCACAGGTTATGGC 3' ||||||||||||||||||||||||| 3' CGAGAAAAAGGAGTGTCCAATACCG 5'
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 9.2 chr8S:91665813..91665837 25/25 Antisense target sf3b4.S
chr4S:80686960..80686984 21/25 Sense off-target LOC108715678 [provisional:fmo5]
Publications
First: Molecular mechanisms of hearing loss in Nager syndrome., Dev Biol 2021  
Most recent: Function of chromatin modifier Hmgn1 during neural crest and craniofacial development., Genesis 2021                
View All Papers