Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-gRNA-23659099

gRNA Name: mtnr1a gRNA1
Synonyms: Xtmtnr1a T1, T1
Genomic Target: mtnr1a

Sequence: 5' GGGGATGCCAGCCAAGGCAG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 19/20
genomic

gRNA
5' CTGCCTTGGCTGGCATCCTC 3' |||||||||||||||||| | 3' GACGGAACCGACCGTAGGGG 5'
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr2S:60733046..60733065 18/20 unknown
chr5L:36402539..36402558 16/20 unknown
tropicalis 10.0 Chr1:43686076..43686095 19/20 Antisense target mtnr1a
Chr1:153579728..153579747 18/20 Antisense off-target cltcl1
Publications
First: CRISPR/Cas9 mediated mutation of the mtnr1a melatonin receptor gene causes rod photoreceptor degeneration in developing Xenopus tropicalis., Sci Rep 2020                                    
Most recent:
View All Papers